Prev. | 

RIKEN DNA Bank Human Resource - LRWD1

Gene ID NCBI Gene 222229 |  KEGG hsa:222229
Gene Symbol LRWD1
Protein Name leucine rich repeats and WD repeat domain containing 1
Synonyms CENP-33|ORCA
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025718 IRAK064E22 pCMV-SPORT6 BC030547 NM_152892
HGY089237 IRAL023B13 pOTB7 BC009436 NM_152892 Partial
HGY096162 IRAL040G18 pOTB7 BC018769 NM_152892 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR432682 RBdS081L18 pGCAP10 NM_152892.1  
GTCAGTTACCGCGGACGCCAGTGCCGGGCTCCAGGAGACGCAGGGCGACGCCACACGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl