Prev. |  KEGG KO K19495 > 

RIKEN DNA Bank Human Resource - JAZF1

Gene ID NCBI Gene 221895 |  KEGG hsa:221895
Gene Symbol JAZF1
Protein Name JAZF zinc finger 1
Synonyms TIP27|ZNF802
Ortholog resource in our bank

  JAZF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029003 IRAK072I11 pBluescriptR BC042441 NM_175061 Full/var
HGY042431 IRAK106B07 pBluescript BC047229 NM_175061 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001139 W01A002O03 pENTR-TOPO IRAK072I11 BC042441 NM_175061  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052484 ARe31D12 pKA1U5 NM_175061.3  
GCCCTCCCTCCCTCGCCCGCCCGGCGCTCGCAGAGCCGACACCAGGGGGGCTCTCGATGT
HKR058906 ARe47E10 pKA1U5 NM_175061.3  
GGACACCAGGGGGGCTCTCGATGTAGCACCATGACAGGCATCGCCGCCGCCTCCTTCTTC
HKR168049 ARi20C01 pGCAP10 NM_175061.3  
GCCCTCCCTCGCCCGCCCGGCGCTCGCAGAGCCGACACCAGGGGGGCTCTCGATGTAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl