Prev. | 

RIKEN DNA Bank Human Resource - LEMD2

Gene ID NCBI Gene 221496 |  KEGG hsa:221496
Gene Symbol LEMD2
Protein Name LEM domain nuclear envelope protein 2
Synonyms CTRCT42|LEM2|NET25|dJ482C21.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX042898 IRAK107E02 pCMV-SPORT6 BC051803 NM_181336

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037770 W01A094H02 pENTR-TOPO IRAK107E02 BC051803 NM_181336  
HGE037774 W01A094H06 pENTR-TOPO IRAK107E02 BC051803 NM_181336  
HGE037776 W01A094H08 pENTR-TOPO IRAK107E02 BC051803 NM_181336  
HGE037778 W01A094H10 pENTR-TOPO IRAK107E02 BC051803 NM_181336  
HGE037786 W01A094H18 pENTR-TOPO IRAK107E02 BC051803 NM_181336  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362901 RBd07E05 pGCAP10 NM_181336.2  
GGGGGGGCGGCGTCCTGGCCATGGCCGGCCTGTCGGACCTGGAACTGCGGCGGGAGCTGC
HKR390173 RBd75H05 pGCAP10 NM_181336.2  
GGCGGCCTCTCCGCGGGCGGAGCCCTGGCTCTCCCAGCCGGCCTCGGGCTCGGCCTACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl