Prev. | 

RIKEN DNA Bank Human Resource - SMIM29

Gene ID NCBI Gene 221491 |  KEGG hsa:221491
Gene Symbol SMIM29
Protein Name small integral membrane protein 29
Synonyms C6orf1|LBH
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX043126 IRAK107N14 pCMV-SPORT6 BC047919 NM_178508 Full/var
HGY093476 IRAL033L12 pOTB7 BC023627 NM_178508 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR022579 ARa56H11 pKA1U5 NM_178508.3  
GGCCCGGGAGCCAACCGAGGGCGTTCCTGTCGGGGCTGCAGCGGCGGGAGGGAGCCCAGT
HKR405302 RBdS013E06 pGCAP10 NM_178508.3  
GCCCATTTCCCCGGGTCCTTTGATCACGCGCCTGACGGCTTTTCCGGGGCCCGGGAGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl