Prev. | 

RIKEN DNA Bank Human Resource - OARD1

Gene ID NCBI Gene 221443 |  KEGG hsa:221443
Gene Symbol OARD1
Protein Name O-acyl-ADP-ribose deacylase 1
Synonyms C6orf130|TARG1|dJ34B21.3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091017 IRAL027J01 pOTB7 BC011709 NM_145063

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219607 ARiS049A07 pGCAP10 NM_145063.2  
AGAGGGGCTCGTTTCCGCCCCGCTACCGGGCGGGGGCGGCCATCTTAGATGCGTGCAATT
HKR405364 RBdS013G20 pGCAP10 NM_145063.2  
GAACCGACTCCTTTCCAGGTGAAGGGTGACTTGGCTGAAGAAACACTTAAATTCTGGAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl