Prev. | 

RIKEN DNA Bank Human Resource - MICU2

Gene ID NCBI Gene 221154 |  KEGG hsa:221154
Gene Symbol MICU2
Protein Name mitochondrial calcium uptake 2
Synonyms 1110008L20Rik|EFHA1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013370 IRAK033H02 pBluescriptR BC034965 NM_152726 Full/var
HGY019541 IRAK048O05 pBluescriptR BC031089 NM_152726

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089224 M01C023A24 pDONR221 MGC01-B12 BC034965 NM_152726  
HGE089272 M01C023C24 pDONR221 MGC01-B12 BC034965 NM_152726  
HGE089320 M01C023E24 pDONR221 MGC01-B12 BC034965 NM_152726  
HGE089368 M01C023G24 pDONR221 MGC01-B12 BC034965 NM_152726  
HGE089416 M01C023I24 pDONR221 MGC01-B12 BC034965 NM_152726  
HGE089464 M01C023K24 pDONR221 MGC01-B12 BC034965 NM_152726  
HGE089512 M01C023M24 pDONR221 MGC01-B12 BC034965 NM_152726  
HGE089560 M01C023O24 pDONR221 MGC01-B12 BC034965 NM_152726  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR324855 RBb12C07 pKA1U5 NM_152726.1  
GGCCGTCTAGCTGCGCTTCCGCAAAGATGGCGGCGGCTGCGGGTAGCTGCGCGCGAGTGG
HKR344083 RBb60D11 pGCAP1 NM_152726.1  
GCTAGCTGCGCTTCCGCAAAGATGGCGGCGGCTGCGGGTAGCTGCGCGCGAGTGGCGGCC
HKR394556 RBd86G12 pGCAP10 NM_152726.1  
GGTCTAGCTGCGCTTCCGCAAAGATGGCGGCGGCTGCGGGTAGCTGCGCGCGAGTGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl