Prev. |  KEGG KO K10860 > 

RIKEN DNA Bank Human Resource - ALKBH3

Gene ID NCBI Gene 221120 |  KEGG hsa:221120
Gene Symbol ALKBH3
Protein Name alkB homolog 3, alpha-ketoglutaratedependent dioxygenase
Synonyms ABH3|DEPC-1|DEPC1|PCA1|hABH3
Ortholog resource in our bank

  ALKBH3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056414 IRAK141A14 pCMV-SPORT6 BC067257 NM_139178 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074452 ARe86C04 pKA1U5 NM_139178.2  
GACTCTTAAGGTTCCGATCACAGACTGCGGAGTGGGTCAGGGGCTGCGAGGGCTGCCCCA
HKR166899 ARi17E03 pGCAP10 NM_139178.2  
GGGAGTGGGTCAGGGGCTGCGAGGGCTGCCCCAAGTCCTACCGGGTTTGCACGGGCGCGC
HKR329371 RBb23H03 pGCAP1 NM_139178.2  
GACTCTTAAGGTTCCGATCACAGACTGCGGAGTGGGTCAGGGGCTGCGAGGGCTGCCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl