Prev. | 

RIKEN DNA Bank Human Resource - HNRNPUL2

Gene ID NCBI Gene 221092 |  KEGG hsa:221092
Gene Symbol HNRNPUL2
Protein Name heterogeneous nuclear ribonucleoprotein U like 2
Synonyms HNRPUL2|SAF-A2
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385282 RBd63D10 pGCAP10 NM_001079559.1  
GGTCGTCCTCCGCGCGCGCCTGCCCGCGGCTGGGGAACCAAGGGCCTGGAGGGGAAACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl