Prev. | 

RIKEN DNA Bank Human Resource - FAM171A1

Gene ID NCBI Gene 221061 |  KEGG hsa:221061
Gene Symbol FAM171A1
Protein Name family with sequence similarity 171 member A1
Synonyms APCN|C10orf38
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04525 SEREX clone NGO-Co-29 (ID 2266) #1 SEREX clone NGO-Co-29 (ID 2266) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY025444 IRAK063K04 pBluescriptR BC034232 NM_001010924 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR189682 ARi74D10 pGCAP10 NM_001010924.1  
GGCCCGCTCTCGGCGAGCCCGAGCCGCCGCCGGCCCCGCGGCGGAGATGAGCAGGTCCGC
HKR361779 RBd04H11 pGCAP10 NM_001010924.1  
GGCTCTCGGCGAGCCCGAGCCGTCGCCGGCCCCGCGGCGGAGATGAGCAGGTCCGCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl