Prev. |  KEGG KO K12741 > 

RIKEN DNA Bank Human Resource - HNRNPA3

Gene ID NCBI Gene 220988 |  KEGG hsa:220988
Gene Symbol HNRNPA3
Protein Name heterogeneous nuclear ribonucleoprotein A3
Synonyms 2610510D13Rik|D10S102|FBRNP|HNRPA3
Ortholog resource in our bank

  HNRNPA3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025646 IRAK064B22 pCMV-SPORT6 BC032437 NM_194247 Partial
HGY100229 IRAL050J13 pOTB7 BC064494 NM_194247 Full/var
HGY101650 IRAL054C02 pOTB7 BC069022 NM_194247.3 Partial/var
HGY103654 IRAL059C06 pOTB7 BC080591 NM_194247 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205490 ARiS013M02 pGCAP10 NM_194247.2  
GGAAGAGGCGAGTCCGGTCTCAAAATGGAGGTAAAACCGCCGCCCGGTCGCCCCCAGCCC
HKR378034 RBd45B10 pGCAP10 NM_194247.2  
GGCCTCTTCCTCTCGGTCCCATATTGAACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAA
HKR405303 RBdS013E07 pGCAP10 NM_194247.2  
GCCCATATTGAACTCNANTTGNAATNGCGAGTCCNGTCTCAAAATGGANGTAATACCNCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl