Prev. |  KEGG KO K12741 > 

RIKEN DNA Bank Human Resource - HNRNPA3

Gene ID NCBI Gene 220988 |  KEGG hsa:220988
Gene Symbol HNRNPA3
Protein Name heterogeneous nuclear ribonucleoprotein A3
Synonyms 2610510D13Rik|D10S102|FBRNP|HNRPA3
Ortholog resources KEGG ortholog (KEGG orthology K12741) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025646 IRAK064B22 pCMV-SPORT6 BC032437 NM_194247 Partial
HGY101650 IRAL054C02 pOTB7 BC069022 NM_194247.3 Partial/var
HGY100229 IRAL050J13 pOTB7 BC064494 NM_194247 Full/var
HGY103654 IRAL059C06 pOTB7 BC080591 NM_194247 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205490 ARiS013M02 pGCAP10 NM_194247.2  
GGAAGAGGCGAGTCCGGTCTCAAAATGGAGGTAAAACCGCCGCCCGGTCGCCCCCAGCCC
HKR378034 RBd45B10 pGCAP10 NM_194247.2  
GGCCTCTTCCTCTCGGTCCCATATTGAACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAA
HKR405303 RBdS013E07 pGCAP10 NM_194247.2  
GCCCATATTGAACTCNANTTGNAATNGCGAGTCCNGTCTCAAAATGGANGTAATACCNCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl