Prev. | 

RIKEN DNA Bank Human Resource - ZNF22-AS1

Gene ID NCBI Gene 220979 |  KEGG hsa:220979
Gene Symbol ZNF22-AS1
Protein Name ZNF22 antisense RNA 1
Synonyms C10orf25
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX054063 IRAK135C15 pCMV-SPORT6 BC062568 NM_001039380 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171635 ARi29B11 pGCAP10 NM_001039380.1  
GACCTCAAGAGCTGTAACCGCCCCTGTGTGTGGTCGAGGCTTTTGAAACCAAACTCTAGC
HKR397611 RBd94A11 pGCAP10 NM_001039380.1  
TGGTTCCCAGCACTCCGCCGGCCGCTCCTCATTGACCCGGCCCGCCCGCCGCGCAGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl