Prev. | 

RIKEN DNA Bank Human Resource - DDIAS

Gene ID NCBI Gene 220042 |  KEGG hsa:220042
Gene Symbol DDIAS
Protein Name DNA damage induced apoptosis suppressor
Synonyms C11orf82|noxin
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019484 IRAK048L20 pBluescriptR BC039268 NM_145018

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090040 M01C025B16 pDONR221 MGC02-D08 BC039268 ENST00000329143  
HGE090088 M01C025D16 pDONR221 MGC02-D08 BC039268 ENST00000329143  
HGE090136 M01C025F16 pDONR221 MGC02-D08 BC039268 ENST00000329143  
HGE090184 M01C025H16 pDONR221 MGC02-D08 BC039268 ENST00000329143  
HGE090232 M01C025J16 pDONR221 MGC02-D08 BC039268 ENST00000329143  
HGE090280 M01C025L16 pDONR221 MGC02-D08 BC039268 ENST00000329143  
HGE090328 M01C025N16 pDONR221 MGC02-D08 BC039268 ENST00000329143  
HGE090376 M01C025P16 pDONR221 MGC02-D08 BC039268 ENST00000329143  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR453164 RBdS132P04 pGCAP10 NM_145018.3  
GGACGCGGGAGATTCGATTGGAAGGCTGCCGGCGTGCTACTGAGTTCGGCCGGTCCGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl