Prev. |  KEGG KO K15137 > 

RIKEN DNA Bank Human Resource - MED19

Gene ID NCBI Gene 219541 |  KEGG hsa:219541
Gene Symbol MED19
Protein Name mediator complex subunit 19
Synonyms DT2P1G7|LCMR1|MED19AS
Ortholog resource in our bank

  MED19

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020359 IRAK050O23 pCMV-SPORT6 BC037223 NM_153450

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE093204 M01C033A04 pDONR221 MGC06-B02 BC037223 NM_153450  
HGE093252 M01C033C04 pDONR221 MGC06-B02 BC037223 NM_153450  
HGE093300 M01C033E04 pDONR221 MGC06-B02 BC037223 NM_153450  
HGE093348 M01C033G04 pDONR221 MGC06-B02 BC037223 NM_153450  
HGE093396 M01C033I04 pDONR221 MGC06-B02 BC037223 NM_153450  
HGE093444 M01C033K04 pDONR221 MGC06-B02 BC037223 NM_153450  
HGE093492 M01C033M04 pDONR221 MGC06-B02 BC037223 NM_153450  
HGE093540 M01C033O04 pDONR221 MGC06-B02 BC037223 NM_153450  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162932 ARi07F12 pGCAP10 NM_153450.1  
GGGCAGACACGGAGACAGCGCCGGGGCGGAGGGTACGATGGAGAATTTCACGGCACTGTT
HKR247416 ARiS118I24 pGCAP10 NM_153450.1  
GGGGGTACTCCTTGAAAGCATTGTCCAATGAAAATTACCAACGGCAGACACGGAGACAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl