Prev. | 

RIKEN DNA Bank Human Resource - AMER2

Gene ID NCBI Gene 219287 |  KEGG hsa:219287
Gene Symbol AMER2
Protein Name APC membrane recruitment protein 2
Synonyms FAM123A
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027791 IRAK069H23 pCMV-SPORT6 BC032653 NM_199138 Partial
HGY030221 IRAK075J05 pBluescriptR BC041392 NM_152704 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE122404 M01C106A04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE122452 M01C106C04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE122500 M01C106E04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE122548 M01C106G04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE122596 M01C106I04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE122644 M01C106K04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE122692 M01C106M04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE122740 M01C106O04 pDONR221 06_13-F02 AK098343 NM_152704  
HGE125627 M01C114B03 pDONR221 06-2_05-G02 AK098343 NM_152704  
HGE125675 M01C114D03 pDONR221 06-2_05-G02 AK098343 NM_152704  
HGE125723 M01C114F03 pDONR221 06-2_05-G02 AK098343 NM_152704  
HGE125771 M01C114H03 pDONR221 06-2_05-G02 AK098343 NM_152704  
HGE125819 M01C114J03 pDONR221 06-2_05-G02 AK098343 NM_152704  
HGE125867 M01C114L03 pDONR221 06-2_05-G02 AK098343 NM_152704  
HGE125915 M01C114N03 pDONR221 06-2_05-G02 AK098343 NM_152704  
HGE125963 M01C114P03 pDONR221 06-2_05-G02 AK098343 NM_152704  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR364130 RBd10F10 pGCAP10 NM_152704.2  
GAGGCGGAGGCCGGGGCCGGGACCGGGACCCTCGCGGCAGACATGGACTTGCATTGTGAC
HKR386073 RBd65D01 pGCAP10 NM_152704.2  
GGAGGAAGGCGGAGGCCGGGGCCGGGACCGGGACCCTCGCGGCAGACATGGACTTGCATT
HKR403070 RBdS007L06 pGCAP10 NM_152704.2  
GAGACATGGACTTGCATTGTGACTGTGCCGCCGAAACGCCGGCCGCCGAGCCGCCGTCGG
HKR461871 RBdS154L07 pGCAP10 NM_152704.2  
GGCTGTCAGCGAGCGCGGCGGAGCTGGCGCGTCCGTGGGGGTCTGCAGGAGGAAGGCGGA
HKR475084 RBdS187L20 pGCAP10 NM_152704.2  
GAGGCAAACTCCACCCCGGGGAGCTGTTGTGCTTGCATTGCTGGGCTGCTGATAGACTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl