Prev. | 

RIKEN DNA Bank Human Resource - MTLN

Gene ID NCBI Gene 205251 |  KEGG hsa:205251
Gene Symbol MTLN
Protein Name mitoregulin
Synonyms LINC00116|MOXI|NCRNA00116|SMIM37
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030223 IRAK075J07 pBluescriptR BC031315

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174498 ARi36E02 pGCAP10 XR_017795.1  
GAGCCATGGCGGATGTGTCAGAGAGGACACTGCAGTTGTCCGTGCTAGTAGCCTTCGCTT
HKR184176 ARi60H08 pGCAP10 XR_017795.1  
GAGACCGCGCTGCACGCCGGCGGCAGCCATGGCGGATGTGTCAGAGAGGACACTGCAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl