Prev. | 

RIKEN DNA Bank Human Resource - CCDC107

Gene ID NCBI Gene 203260 |  KEGG hsa:203260
Gene Symbol CCDC107
Protein Name coiled-coil domain containing 107
Synonyms PSEC0222
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096345 IRAL040O09 pOTB7 BC018758 NM_174923
HGY099143 IRAL047O07 pOTB7 BC051285 NM_174923 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054483 ARe36D11 pKA1U5 NM_174923.1  
GACCCGTGGGCCGGCAATGGCGGGCGCAGTTTCGCTCTTGGGTGTGGTGGGGCTGCTGCT
HKR222116 ARiS055E20 pGCAP10 NM_174923.1  
GGGAGACCGCGCCAATCCCGACCTCCGGGCACACCCAGGGAACGCAGCCCACCCCGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl