Prev. | 

RIKEN DNA Bank Human Resource - PAXIP1-AS1

Gene ID NCBI Gene 202781 |  KEGG hsa:202781
Gene Symbol PAXIP1-AS1
Protein Name PAXIP1 antisense RNA 1 (head to head)
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY042591 IRAK106H23 pBluescript BC048116

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR390124 RBd75F04 pGCAP10 XM_001715403.1  
GGTGGGGCCTTGGGGCCGCGAGTGGGAGCGGGAGCGGTTCTGCGGCCTCCTCGGGCTTCT
HKR394431 RBd86B07 pGCAP10 XM_001715403.1  
GCTCCTCGGGCTTCTTGGCCCTGGGCAGAGTGGGATTGGGTGTCCCGGCTGTTCGCAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl