Prev. | 

RIKEN DNA Bank Human Resource - DENND6A

Gene ID NCBI Gene 201627 |  KEGG hsa:201627
Gene Symbol DENND6A
Protein Name DENN domain containing 6A
Synonyms AFI1A|FAM116A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028524 IRAK071F04 pBluescriptR BC040291 NM_152678
HGX046377 IRAK115P17 pCMV-SPORT6 BC054343 NM_152678 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090425 M01C026B01 pDONR221 MGC02-G01 BC040291 ENST00000311128  
HGE090473 M01C026D01 pDONR221 MGC02-G01 BC040291 ENST00000311128  
HGE090521 M01C026F01 pDONR221 MGC02-G01 BC040291 ENST00000311128  
HGE090569 M01C026H01 pDONR221 MGC02-G01 BC040291 ENST00000311128  
HGE090617 M01C026J01 pDONR221 MGC02-G01 BC040291 ENST00000311128  
HGE090665 M01C026L01 pDONR221 MGC02-G01 BC040291 ENST00000311128  
HGE090713 M01C026N01 pDONR221 MGC02-G01 BC040291 ENST00000311128  
HGE090761 M01C026P01 pDONR221 MGC02-G01 BC040291 ENST00000311128  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166082 ARi15D10 pGCAP10 NM_152678.2  
GAAGCGCGCTCTGCGGCGCGGTCCGCTGTGGAGGCGGCGCGAACGGTCAGGGGGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl