Prev. |  KEGG KO K02891 > 

RIKEN DNA Bank Human Resource - RPL22L1

Gene ID NCBI Gene 200916 |  KEGG hsa:200916
Gene Symbol RPL22L1
Protein Name ribosomal protein L22 like 1
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K02891) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY098864 IRAL047C16 pOTB7 BC049823
HGY100763 IRAL051P03 pDNR-LIB BC062731

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066449 ARe66C01 pKA1U5 NM_001099645.1  
GCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAGA
HKR182927 ARi57F07 pGCAP10 NM_001099645.1  
CGGCCGGCCGATGCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACA
HKR205550 ARiS013O14 pGCAP10 NM_001099645.1  
GAGTTCAACCACAGCCACCCGCGTGTGCCCGCGGAAAGCCGATGGCCTACTCTCGTCCGG
HKR218277 ARiS045L13 pGCAP10 NM_001099645.1  
GCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAGA
HKR222205 ARiS055I13 pGCAP10 NM_001099645.1  
GCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAGA
HKR247477 ARiS118L13 pGCAP10 NM_001099645.1  
GCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGAAAGACAGGAAGCCCAAGAGGT
HKR277864 ARiS194K24 pGCAP10 NM_001099645.1  
TCCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAG
HKR390128 RBd75F08 pGCAP10 NM_001099645.1  
GCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAGA
HKR402849 RBdS007C01 pGCAP10 NM_001099645.1  
GCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAGA
HKR428106 RBdS070E10 pGCAP10 NM_001099645.1  
TGCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl