RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SPRED2

Gene ID	NCBI Gene 200734 \| KEGG hsa:200734
Gene Symbol	SPRED2
Protein Name	sprouty related EVH1 domain containing 2
Synonyms	Spred-2

Ortholog resource in our bank

  SPRED2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR363202	RBd08A02	pGCAP10	NM_181784.2
HKR363202	TGCTCCTCCTCCTCGCAGCAGTCCCTGCCGCTCCGAGGCGCGCTTGTTTTTCTCCTGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl