Prev. | 

RIKEN DNA Bank Human Resource - KRTCAP3

Gene ID NCBI Gene 200634 |  KEGG hsa:200634
Gene Symbol KRTCAP3
Protein Name keratinocyte associated protein 3
Synonyms KCP3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR124080 ARh10D08 pGCAP1 NM_173853.2 done
GGGCCCTGCGGCTGGCGCGGCGGACGGGATGAGGCGCTGCAGTCTCTGCGCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl