Prev. |  KEGG KO K18260 > 

RIKEN DNA Bank Human Resource - CC2D1B

Gene ID NCBI Gene 200014 |  KEGG hsa:200014
Gene Symbol CC2D1B
Protein Name coiled-coil and C2 domain containing 1B
Synonyms -
Ortholog resource in our bank

  CC2D1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009049 IRAK022K09 pCMV-SPORT6 BC016880 NM_032449 Partial/var
HGY088285 IRAL020L21 pOTB7 BC007912 NM_032449 Partial/var
HGY091468 IRAL028L04 pOTB7 BC014080 NM_032449 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060012 ARe50A12 pKA1U5 NM_032449.1  
ACCGCTGCGGCCCAGGGCCCGCGGGAGCCCAGGGCGGTGCCGGGTGAGACAAGGCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl