Prev. | 

RIKEN DNA Bank Human Resource - FAAP20

Gene ID NCBI Gene 199990 |  KEGG hsa:199990
Gene Symbol FAAP20
Protein Name FA core complex associated protein 20
Synonyms C1orf86|FP7162
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067391 IRAK168H23 pBluescriptR BC066360 NM_182533 Partial/var
HGX069733 IRAK174F13 pCMV-SPORT6 BC078145 NM_182533 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE083603 M01C009A03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  
HGE083651 M01C009C03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  
HGE083699 M01C009E03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  
HGE083747 M01C009G03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  
HGE083795 M01C009I03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  
HGE083843 M01C009K03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  
HGE083891 M01C009M03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  
HGE083939 M01C009O03 pDONR221 FLJ02-A02 AK055593 ENST00000359030  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR175722 ARi39F02 pGCAP10 NM_182533.2  
GGGGGCTTGCGCTCACTTCCGCCCGGCGCGGGCTTGGATGGAGGCGGCGCGGAGGCCGCG
HKR234154 ARiS085G10 pGCAP10 NM_182533.2  
ACTTCCGCCCGGCGCGGGCTTGGATGGAGGCGGCGCGGAGGCCGCGGCTGGGGTTGAGCC
HKR243695 ARiS109D23 pGCAP10 NM_182533.2  
GGCGGGCTTGGATGGAGGCGGCGCGGAGGCCGCGGCTGGGGTTGAGCCGCCGGAGGCCGC
HKR325305 RBb13E09 pKA1U5 NM_182533.2  
ACTTCCGCCCGGCGCGGGCTTGGATGGAGGCGGCGCGGAGGCCGCGGCTGGGGTTGAGCC
HKR345630 RBb64B06 pGCAP1 NM_182533.2  
TGGCGCGGGCTTGGATGGAGGCGGCGCGGAGGCCGCGGCTGGGGTTGAGCCGCCGGAGGC
HKR405452 RBdS013K12 pGCAP10 NM_182533.2  
GACTTCCGCCCGGCGCGGGCTTGGATGGAGGCGGCGCGGAGGCCGCGGCTGGGGTTGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl