Prev. | 

RIKEN DNA Bank Human Resource - NSMCE1

Gene ID NCBI Gene 197370 |  KEGG hsa:197370
Gene Symbol NSMCE1
Protein Name NSE1 homolog, SMC5-SMC6 complex component
Synonyms NSE1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088046 IRAL020B22 pOTB7 BC018938 NM_145080 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068498 ARe71E02 pKA1U5 NM_145080.3  
GAGCGCGGCCTGGGATGCGCTTGGGCTCCCTGTTCGTTCCCACATGCAGGGCAGCACAAG
HKR077657 ARe94C09 pKA1U5 NM_145080.3  
GGGCCTGGGATGCGCTTGGGCTCCCTGTTCGTTCCCACATGCAGGGCAGCACAAGGAGAA
HKR082026 ARf05B02 pKA1U5 NM_145080.3  
GGGGATGCGCTTGGGCTCCCTGTTCGTTCCCACATGCAGGGCAGCACAAGGAGAATGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl