Prev. |  KEGG KO K19500 > 

RIKEN DNA Bank Human Resource - ANO6

Gene ID NCBI Gene 196527 |  KEGG hsa:196527
Gene Symbol ANO6
Protein Name anoctamin 6
Synonyms BDPLT7|SCTS|TMEM16F
Ortholog resource in our bank

  ANO6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY042716 IRAK106N04 pBluescript BC042383 NM_001025356 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077234 ARe93B10 pKA1U5 NM_001025356.2  
GAGTCTCCGGGCTCCGCTCGGCAGGCGAGAGGCNTCCTCCGGCTCTGGGCTCCGGTCGGT
HKR276496 ARiS191D24 pGCAP10 NM_001025356.2  
GGGCCNTGCTCAGTCTCCGGGCTCCGCTCGGCAGGCGAGAGGCGTCCTCCGGCTCTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl