Prev. |  KEGG KO K06058 > 

RIKEN DNA Bank Human Resource - DTX3

Gene ID NCBI Gene 196403 |  KEGG hsa:196403
Gene Symbol DTX3
Protein Name deltex E3 ubiquitin ligase 3
Synonyms RNF154|deltex3
Featured content Notch signaling pathway (human)
Ortholog resource in our bank

  DTX3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402870 RBdS007C22 pGCAP10 NM_178502.2 Full done
GATGTGACCGGCAATGGCGGCGCTGACGAGAGCTGCATTTGGAAGTGTTGTGGAGACAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl