Prev. | Human A to Z list > D > 

RIKEN DNA Bank Human Resource - DTX3

Gene ID (NCBI) 196403
Gene Symbol DTX3
Protein Name deltex E3 ubiquitin ligase 3
Synonyms RNF154|deltex3
Databases KEGG hsa:196403 |  NCBI Gene 196403
Featured content Notch signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06058)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR402870 RBdS007C22 pGCAP10 NM_178502.2  
GATGTGACCGGCAATGGCGGCGCTGACGAGAGCTGCATTTGGAAGTGTTGTGGAGACAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl