Prev. |  KEGG KO K18693 > 

RIKEN DNA Bank Human Resource - PLPP4

Gene ID NCBI Gene 196051 |  KEGG hsa:196051
Gene Symbol PLPP4
Protein Name phospholipid phosphatase 4
Synonyms DPPL2|PPAPDC1|PPAPDC1A
Ortholog resources KEGG ortholog (KEGG orthology K18693) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045698 ARe14E02 pKA1U5 NM_001030059.1  
GGCGGGTGCCCGGCNCGGGCCCAGGAGGCGGAGGCGGCTCCTGGGGAGAGGGATCCGGGA
HKR072946 ARe82G02 pKA1U5 NM_001030059.1  
GGGGCCCAGGAAGGCGGAGGCGGCTCCTGGGGAGAGGGATCCGGGAGTCCCTGAGGCGGC
HKR078827 ARe97B03 pKA1U5 NM_001030059.1  
GGTGCCCGGCGCGGGCCCAGGAGGCGGAGGCGGCTCCTGGGGAGAGGGATCCGGGAGTCC
HKR169681 ARi24D09 pGCAP10 NM_001030059.1  
GGCGCCTCCCTCGCCTCCCAGGGTCTGGCGAGCCGGCGCCGGCCGAGCTGCGGGAGCCGC
HKR184950 ARi62G06 pGCAP10 NM_001030059.1  
TGCGGAGCACCAGCTGACGCCGCGGGAGCTGCTCCGGCCGCACCATGCGGGAGCTGGCCA
HKR184951 ARi62G07 pGCAP10 NM_001030059.1  
TGCGGAGCACCAGCTGACGCCGCGGGAGCTGCTCCGGCCGCACCATGCGGGAGCTGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl