Prev. | 

RIKEN DNA Bank Human Resource - ZNF367

Gene ID NCBI Gene 195828 |  KEGG hsa:195828
Gene Symbol ZNF367
Protein Name zinc finger protein 367
Synonyms AFF29|CDC14B|ZFF29
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056531 ARe41F11 pKA1U5 NM_153695.3  
GGAAATGTAACGCGGGAAAAGCCGGGGCAGGCACCGCGGCGGCAGGTTGTTATTTTTGGG
HKR249087 ARiS122L23 pGCAP10 NM_153695.3  
GGCTTTCCTGTCACCGCAAGGGCCGGGCCGCCCGCTGCTTCCCACCCCTGCAGCCTGCGC
HKR432635 RBdS081J19 pGCAP10 NM_153695.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl