Prev. | 

RIKEN DNA Bank Human Resource - PRXL2C

Gene ID NCBI Gene 195827 |  KEGG hsa:195827
Gene Symbol PRXL2C
Protein Name peroxiredoxin like 2C
Synonyms AAED1|C9orf21
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR390011 RBd75A11 pGCAP10 NM_153698.1  
GAGGCCCTCGGCCGCCCCGCGTCATGGCCGCGCCGGCCCCGGTCACGCGGTAGGTTAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl