Prev. |  KEGG KO K19995 > 

RIKEN DNA Bank Human Resource - SCAMP5

Gene ID NCBI Gene 192683 |  KEGG hsa:192683
Gene Symbol SCAMP5
Protein Name secretory carrier membrane protein 5
Synonyms -
Ortholog resource in our bank

  SCAMP5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011981 IRAK029P21 pCMV-SPORT6 BC024700 NM_138967 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR369708 RBd24E12 pGCAP10 NM_138967.2  
GGGAGCGGCTCGCGGCCGGCTCCGCGCCGCATCGCTCGGGTGCAGCGCAGCTCAGCGCAG
HKR370053 RBd25C05 pGCAP10 NM_138967.2  
GGGCTCCGCGCCGCATCGCTCGGGTGCAGCGCAGCTCAGCGCAGCGCTGCGGCCTTTCGG
HKR388482 RBd71D10 pGCAP10 NM_138967.2  
CGGCCGGCCGATGGCGCGGCCGGCTCCGCGCCGCATCGCTCGGGTGCAGCGCAGCTCAGC
HKR462738 RBdS156O02 pGCAP10 NM_138967.2  
GGCGGCCGGCTCCGCGCCGCATCGCTCGGGTGCAGCGCAGCTCAGCGCAGCGCTGCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl