Prev. | 

RIKEN DNA Bank Human Resource - HIGD2A

Gene ID NCBI Gene 192286 |  KEGG hsa:192286
Gene Symbol HIGD2A
Protein Name HIG1 hypoxia inducible domain family member 2A
Synonyms RCF1b
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082002 IRAL005A02 pOTB7 BC000587 NM_138820.4
HGY084201 IRAL010I09 pOTB7 BC007502 NM_138820

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168036 ARi20B12 pGCAP10 NM_138820.2  
TGCCCTTTCATGACCTTCACCGGGAGGCTGAGGTCGGAGTCCCGATTTTCTCCTGCTGCT
HKR209575 ARiS023P15 pGCAP10 NM_138820.2  
TGCCCTTTCATGACCTTCACCGGGAGGCTGAGGTCGGAGTCCCGATTTTCTCCTGCTGCT
HKR260296 ARiS150M08 pGCAP10 NM_138820.2  
GCCTTTCATGACCTTCACCGGGAGGCTGAGGTCGGAGTCCCGATTTTCTCCTGCTGCTGT
HKR340570 RBb51H02 pGCAP1 NM_138820.2  
GCCCTTTCATGACCTTCACCGGGAGGCTGAGGTCGGAGTCCCGATTTTCTCCTGCTGCTG
HKR405208 RBdS013A08 pGCAP10 NM_138820.2  
GGAGGTCGGAGTCCCGATTTTCTCCTGCTGCTGTGGCCCGGACATGGCGACTCCCGGCCC
HKR428232 RBdS070J16 pGCAP10 NM_138820.2  
GCCCTTTCATGACCTTCACCGGGAGGCTGAGGTCGGAGTCCCGATTTTCTCCTGCTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl