Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASXL1

Gene ID (NCBI) 171023
Gene Symbol ASXL1
Protein Name additional sex combs like 1 (Drosophila)
Synonyms BOPS|MDS
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011797 IRAK029I05 pCMV-SPORT6 BC033284 NM_015338 Partial/var
HGY100006 IRAL050A06 pOTB7 BC064984 NM_015338 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR348524 RBb71F04 pGCAP1 NM_015338.4
GGCCCCTCCCCCACCGCCGCTCTCGCGCCAGCCGGTCCCCGCGTGCCCGCCCCTTCTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.09.12

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160825.pl