Prev. |  KEGG KO K11471 > 

RIKEN DNA Bank Human Resource - ASXL1

Gene ID NCBI Gene 171023 |  KEGG hsa:171023
Gene Symbol ASXL1
Protein Name ASXL transcriptional regulator 1
Synonyms BOPS|MDS
Ortholog resources KEGG ortholog (KEGG orthology K11471) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011797 IRAK029I05 pCMV-SPORT6 BC033284 NM_015338 Partial/var
HGY100006 IRAL050A06 pOTB7 BC064984 NM_015338 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348524 RBb71F04 pGCAP1 NM_015338.4 done
GGCCCCTCCCCCACCGCCGCTCTCGCGCCAGCCGGTCCCCGCGTGCCCGCCCCTTCTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl