Prev. | 

RIKEN DNA Bank Human Resource - COMMD6

Gene ID NCBI Gene 170622 |  KEGG hsa:170622
Gene Symbol COMMD6
Protein Name COMM domain containing 6
Synonyms Acrg
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049284 ARe23D12 pKA1U5 NM_203497.2  
GCTCTCGAGTCCGGGCCGCAAGTCCCAGACGCTGCCCATGGAGGCGTCCAGCGAGCCGCC
HKR060921 ARe52F01 pKA1U5 NM_203497.2  
GCTCTCGAGTCCGGGCCGCAAGTCCCAGACGCTGCCCATGGCAGGCGTCCAGCGAGCCGC
HKR064055 ARe60C07 pKA1U5 NM_203497.2  
GGCCGCAAGTCCCAGACGCTGCCCATGGAGGCGTCCAGCGAGCCGCCGCTGGATGCTAAG
HKR160480 ARi01D08 pGCAP10 NM_203497.2  
GGTTCTCTCGAGTCCGGGCCGCAAGTCCCAGACGCTGCCCATGGAGGCGTCCAGCGAGCC
HKR184973 ARi62H05 pGCAP10 NM_203497.2  
GGGGGCGTTCTCTCGAGTCCGGGCCGCAAGTCCCAGACGCTGCCCATGGAGGCGTCCAGC
HKR234861 ARiS087C13 pGCAP10 NM_203497.2  
GNTCTCGAGTCCGGGCCGCAAGTCCCAGACGCTGCCCATGGAGGCGTCCAGCGAGCCGCC
HKR393653 RBd84C05 pGCAP10 NM_203497.2  
GGGTCTGGGGGCGTTCTCTCGAGTCCGGGCCGCAAGTCCCAGACGCTGCCCATGGAGGCG
HKR406209 RBdS015I17 pGCAP10 NM_203497.2  
GGTTCTCTCGAGTCCGGGCCGCAAGTCCCAGACGCTGCCCATGGAGGCGTCCAGCGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl