Prev. | 

RIKEN DNA Bank Human Resource - SSBP4

Gene ID NCBI Gene 170463 |  KEGG hsa:170463
Gene Symbol SSBP4
Protein Name single stranded DNA binding protein 4
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082692 IRAL006M04 pOTB7 BC000274 NM_032627 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001859 W01A004K19 pENTR-TOPO IRAL006M04 BC000274 NM_032627  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR189278 ARi73D06 pGCAP10 NM_001009998.1  
GAGCCCGCGCGGAGGAAAGGGAGGAAAAAAAGCCACCCTGCGGCCGGGGCCGGAGCTGGA
HKR433530 RBdS083N18 pGCAP10 NM_001009998.1  
GGGGAGGAGGGGAGCGCGCGTTTCCCGGAACAGCCCGCGCGGAGGAAAGGGAGGAAAAAA
HKR452941 RBdS132F21 pGCAP10 NM_001009998.1  
TGGAGGGAGGAAAAAAAGCCACCCTGCGGCCGGGGCCGGAGCTGGAGCCGCCGCTGCCGC
HKR452994 RBdS132I02 pGCAP10 NM_001009998.1  
GGGGCGCGCGCGGCGGGAGGAGGGGAGCGCGCGTTTCCCGGAACAGCCCGCGCGGAGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl