Prev. | 

RIKEN DNA Bank Human Resource - TIGD2

Gene ID NCBI Gene 166815 |  KEGG hsa:166815
Gene Symbol TIGD2
Protein Name tigger transposable element derived 2
Synonyms HEL106
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051345 ARe28G01 pKA1U5 NM_145715.2  
GGCTCGCTCCCTCGCCGCTGCCGGGCCACCAGNTGCCAGCCTGCCTCAGGAGACTCCATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl