Prev. |  KEGG KO K16487 > 

RIKEN DNA Bank Human Resource - SASS6

Gene ID NCBI Gene 163786 |  KEGG hsa:163786
Gene Symbol SASS6
Protein Name SAS-6 centriolar assembly protein
Synonyms MCPH14|SAS-6|SAS6
Ortholog resource in our bank

  SASS6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099440 IRAL048J24 pDNR-LIB BC054889 NM_194292 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR336170 RBb40H02 pGCAP1 NM_194292.1  
TTAAGTCTCTTACGCCTTCCCCTCGTTTCTCCCTCCCCGCCTCCTCCGCAGAAGCCGAGC
HKR402954 RBdS007G10 pGCAP10 NM_194292.1  
GCTCCGCAGAAGCCGAGCGCCAAACTCAAACTTTATCAGGACCCGGACCTCTCAGGCTAA
HKR420484 RBdS051D12 pGCAP10 NM_194292.1  
GACGCCTTCCCCTCGTTTCTCCCTCCCCGCCTCCTCCGCAGAAGCCGAGCGCCAAACTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl