Prev. | 

RIKEN DNA Bank Human Resource - EID2

Gene ID NCBI Gene 163126 |  KEGG hsa:163126
Gene Symbol EID2
Protein Name EP300 interacting inhibitor of differentiation 2
Synonyms CRI2|EID-2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091360 IRAL028G16 pOTB7 BC030137 NM_153232 Full
HGY103553 IRAL058O17 pOTB7 BC071854 NM_153232 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE106006 M01C065A06 pDONR221 06_07-B03 BC030137 NM_153232  
HGE106054 M01C065C06 pDONR221 06_07-B03 BC030137 NM_153232  
HGE106102 M01C065E06 pDONR221 06_07-B03 BC030137 NM_153232  
HGE107247 M01C068B23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE107295 M01C068D23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE107343 M01C068F23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE107391 M01C068H23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE107439 M01C068J23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE107487 M01C068L23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE107535 M01C068N23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE107583 M01C068P23 pDONR221 06_08-G12 BC030137 NM_153232  
HGE124447 M01C111B23 pDONR221 06-2_04-C12 BC030137 NM_153232  
HGE124495 M01C111D23 pDONR221 06-2_04-C12 BC030137 NM_153232  
HGE124543 M01C111F23 pDONR221 06-2_04-C12 BC030137 NM_153232  
HGE124591 M01C111H23 pDONR221 06-2_04-C12 BC030137 NM_153232  
HGE124820 M01C112A20 pDONR221 06-2_04-F10 BC030137 NM_153232  
HGE124868 M01C112C20 pDONR221 06-2_04-F10 BC030137 NM_153232  
HGE124916 M01C112E20 pDONR221 06-2_04-F10 BC030137 NM_153232  
HGE124964 M01C112G20 pDONR221 06-2_04-F10 BC030137 NM_153232  
HGE125012 M01C112I20 pDONR221 06-2_04-F10 BC030137 NM_153232  
HGE125060 M01C112K20 pDONR221 06-2_04-F10 BC030137 NM_153232  
HGE125108 M01C112M20 pDONR221 06-2_04-F10 BC030137 NM_153232  
HGE125156 M01C112O20 pDONR221 06-2_04-F10 BC030137 NM_153232  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE030534 W01A076F14 pENTR-TOPO flj0078h01 AK128468 NM_153232  
HGE030536 W01A076F16 pENTR-TOPO flj0078h01 AK128468 NM_153232  
HGE030544 W01A076F24 pENTR-TOPO flj0078h01 AK128468 NM_153232  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330505 RBb26E09 pGCAP1 NM_153232.3  
GGGTAAGAATCTATGCTCTCGCGCCCGGTTACGCACACATGCCATTTACAGCGCGCATAG
HKR430324 RBdS075N12 pGCAP10 NM_153232.3  
GTCCAGTTTCTCTGGGAGCAGCCNATTTGACCCCACGGTCTGAGATGTCCAAGCTGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl