Prev. | 

RIKEN DNA Bank Human Resource - DEDD2

Gene ID NCBI Gene 162989 |  KEGG hsa:162989
Gene Symbol DEDD2
Protein Name death effector domain containing 2
Synonyms FLAME-3|FLAME3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019642 IRAK049B18 pCMV-SPORT6 BC027930 NM_133328
HGY090128 IRAL025F08 pOTB7 BC013372 NM_133328 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001444 W01A003K04 pENTR-TOPO IRAK049B18 BC027930 NM_133328 done
HGE001446 W01A003K06 pENTR-TOPO IRAK049B18 BC027930 NM_133328  
HGE001448 W01A003K08 pENTR-TOPO IRAK049B18 BC027930 NM_133328  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR377355 RBd43G11 pGCAP10 NM_133328.2  
GGGGAAGGAGGAGGGGCGAGGTGACGCAGGCGTAATAATAGAGAAGGTGCCAGAAAGATC
HKR428021 RBdS070A21 pGCAP10 NM_133328.2  
GAGAGAAGGTGCCAGAAAGATCCAAAACAAGTGGCTGCGGCCGTCGCCCAGGAGTCATCG
HKR461850 RBdS154K10 pGCAP10 NM_133328.2  
NNNTTGTGANNTCGGNNTNATGNNNNNNANNGNNNNNNAAANGNNNNAACAANNGNNNGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl