Prev. | 

RIKEN DNA Bank Human Resource - GPR180

Gene ID NCBI Gene 160897 |  KEGG hsa:160897
Gene Symbol GPR180
Protein Name G protein-coupled receptor 180
Synonyms ITR
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY098931 IRAL047F11 pOTB7 BC052243 NM_180989 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092846 M01C032B22 pDONR221 MGC05-H11 BC052243 NM_180989  
HGE092894 M01C032D22 pDONR221 MGC05-H11 BC052243 NM_180989  
HGE092942 M01C032F22 pDONR221 MGC05-H11 BC052243 NM_180989  
HGE092990 M01C032H22 pDONR221 MGC05-H11 BC052243 NM_180989  
HGE093038 M01C032J22 pDONR221 MGC05-H11 BC052243 NM_180989  
HGE093086 M01C032L22 pDONR221 MGC05-H11 BC052243 NM_180989  
HGE093134 M01C032N22 pDONR221 MGC05-H11 BC052243 NM_180989  
HGE093182 M01C032P22 pDONR221 MGC05-H11 BC052243 NM_180989  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166521 ARi16F01 pGCAP10 NM_180989.4  
GGACGTGGGGCGGGCAGCCGCCGGCGGCTGGGAGCCGAGGCGTCGGTGCAGACCTGGAGA
HKR173700 ARi34E04 pGCAP10 NM_180989.4  
GGGGGCGGGCAGCCGCCGGCGGCTGGGAGCCGAGGCGTCGGTGCAGACCTGGAGACGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl