Prev. | 

RIKEN DNA Bank Human Resource - FAM120AOS

Gene ID NCBI Gene 158293 |  KEGG hsa:158293
Gene Symbol FAM120AOS
Protein Name family with sequence similarity 120A opposite strand
Synonyms C9orf10OS
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025863 IRAK064K23 pCMV-SPORT6 BC037551 NM_198841 Partial
HGX031550 IRAK078O14 pCMV-SPORT6 BC038803 NM_198841 Partial/var
HGX042873 IRAK107D01 pCMV-SPORT6 BC046183 NM_198841 Partial/var
HGX053923 IRAK134N11 pCMV-SPORT6.ccdb BC063650 NM_198841 Partial
HGY103904 IRAL059M16 pOTB7 BC080634 NM_198841 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362102 RBd05E06 pGCAP10 NM_198841.2  
GGCCCAGGCCCGCCGGCTAGCAGGCGGAAGAGGCGGCGCCGGCGGGACGCGGCTCGGGGC
HKR362973 RBd07H05 pGCAP10 NM_198841.2  
GGTTCTGGACATGGCTGACGATCTGCTGTGCCGTCTGGCGCTCGTTGCCCTGCCGCTTGA
HKR433432 RBdS083J16 pGCAP10 NM_198841.2  
GGGGGCTCCCGGAGGCGGCGGCGGAGGCGGAGGCCCGGAGTTGGGCCGGGACGGGATCCG
HKR433470 RBdS083L06 pGCAP10 NM_198841.2  
GGGGGCTCCCGGAGGCGGCGGCGGAGGCGGAGGCCCGGAGTTGGGCCGGGACGGGATCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl