Prev. | 

RIKEN DNA Bank Human Resource - TTC39B

Gene ID NCBI Gene 158219 |  KEGG hsa:158219
Gene Symbol TTC39B
Protein Name tetratricopeptide repeat domain 39B
Synonyms C9orf52
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR122856 ARh07C08 pGCAP1 NM_152574.1  
GCCCCTTTTGCCCTCCTTTGCGCTGGGCTGAGCCCAGAGCCGAGAGCAGGAGTCGGCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl