Prev. | 

RIKEN DNA Bank Human Resource - C9orf163

Gene ID NCBI Gene 158055 |  KEGG hsa:158055
Gene Symbol C9orf163
Protein Name chromosome 9 open reading frame 163
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR399275 RBd98D03 pGCAP10 NM_152571.2 Full done
GGCCCCTCGCCACCTGCCCGGCCAGGCGCGCCGGGGCCGTCCCAGTACGTCGCCCTGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl