Prev. | 

RIKEN DNA Bank Human Resource - LRATD2

Gene ID NCBI Gene 157638 |  KEGG hsa:157638
Gene Symbol LRATD2
Protein Name LRAT domain containing 2
Synonyms BCMP101|FAM84B|NSE2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036315 IRAK090N03 pBluescript BC052957 NM_174911

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE090835 M01C027B11 pDONR221 MGC03-C06 BC052957 ENST00000304916  
HGE090883 M01C027D11 pDONR221 MGC03-C06 BC052957 ENST00000304916  
HGE090931 M01C027F11 pDONR221 MGC03-C06 BC052957 ENST00000304916  
HGE090979 M01C027H11 pDONR221 MGC03-C06 BC052957 ENST00000304916  
HGE091027 M01C027J11 pDONR221 MGC03-C06 BC052957 ENST00000304916  
HGE091075 M01C027L11 pDONR221 MGC03-C06 BC052957 ENST00000304916  
HGE091123 M01C027N11 pDONR221 MGC03-C06 BC052957 ENST00000304916  
HGE091171 M01C027P11 pDONR221 MGC03-C06 BC052957 ENST00000304916  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045703 ARe14E07 pKA1U5 NM_174911.3  
GGTTGCTCGCCCGGCCCAAGCGGGAGCTGTTGCCGCCAGGCTGCGAGGCTGCCGTCCTCT
HKR049708 ARe24E12 pKA1U5 NM_174911.3  
GCCTGTCTCTTTAAATGCCACGGGCTGCGCTCCCGCCCGGGAGCCCGGAGCCGGATCTAC
HKR054930 ARe37F10 pKA1U5 NM_174911.3  
GGCCTGTCTCTTTAAATGCCACGGGCTGCGCTCCCGCCCGGGAGCCCGGAGCCGGATCTA
HKR168903 ARi22E07 pGCAP10 NM_174911.3  
GGTTGCTCGCCCGGCCCAAGCGGGAGCTGTTGCCGCCAGGCTGCGAGGCTGCCGTCCTCT
HKR172003 ARi30A03 pGCAP10 NM_174911.3  
GGTTGCTCGCCCGGCCCAAGCGGGAGCTGTTGCCGCCAGGCTGCGAGGCTGCCGTCCTCT
HKR176530 ARi41F10 pGCAP10 NM_174911.3  
GGCCTGTCTCTTTAAATGCCACGGGCTGCGCTCCCGCCCGGGAGCCCGGAGCCGGATCTA
HKR181324 ARi53F04 pGCAP10 NM_174911.3  
GAGCCCGGAGCCGGATCTACAATCCCGTCCCTCCAGCTCCGGTGCTTGTTGCTCGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl