Prev. |  KEGG KO K11268 > 

RIKEN DNA Bank Human Resource - ESCO2

Gene ID NCBI Gene 157570 |  KEGG hsa:157570
Gene Symbol ESCO2
Protein Name establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms 2410004I17Rik|EFO2|EFO2p|RBS|hEFO2
Ortholog resource in our bank

  ESCO2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094755 IRAL036O19 pDNR-LIB BC017933 NM_001017420 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE105208 M01C063A08 pDONR221 06_06-B04 AK124215 NM_001017420  
HGE105256 M01C063C08 pDONR221 06_06-B04 AK124215 NM_001017420  
HGE105304 M01C063E08 pDONR221 06_06-B04 AK124215 NM_001017420  
HGE105352 M01C063G08 pDONR221 06_06-B04 AK124215 NM_001017420  
HGE124407 M01C111A07 pDONR221 06-2_04-A04 AK124215 NM_001017420  
HGE124455 M01C111C07 pDONR221 06-2_04-A04 AK124215 NM_001017420  
HGE124503 M01C111E07 pDONR221 06-2_04-A04 AK124215 NM_001017420  
HGE124551 M01C111G07 pDONR221 06-2_04-A04 AK124215 NM_001017420  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR408962 RBdS022G18 pGCAP10 NM_001017420.2  
GATTTTGAAGACGCTCACGGAGCGGCTGGCTAGGCTGAGGAGAGCTCGCCGGGCTCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl