Prev. |  KEGG KO K17590 > 

RIKEN DNA Bank Human Resource - CDCA2

Gene ID NCBI Gene 157313 |  KEGG hsa:157313
Gene Symbol CDCA2
Protein Name cell division cycle associated 2
Synonyms PPP1R81|Repo-Man
Ortholog resource in our bank

  CDCA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY025329 IRAK063F09 pBluescriptR BC036214 NM_152562 Partial/var
HGX053925 IRAK134N13 pCMV-SPORT6.ccdb BC063651 NM_152562 Partial
HGY093465 IRAL033L01 pOTB7 BC015691 NM_152562 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362578 RBd06H10 pGCAP10 NM_152562.2 done
GAGGATCAGCGCAGGCTGTGAGTCCAGGACGCCCGTCCGGACCTCGGGCTCCGGGTTCGA
HKR441804 RBdS104I12 pGCAP10 NM_152562.2  
GGGAGGAGGCTGCCGGGCAGAGCGCAGGCCAGGATCAGCGCGGGCTGTGAGTCCAGGTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl