Prev. | 

RIKEN DNA Bank Human Resource - METTL27

Gene ID NCBI Gene 155368 |  KEGG hsa:155368
Gene Symbol METTL27
Protein Name methyltransferase like 27
Synonyms WBSCR27
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025182 IRAK062P22 pCMV-SPORT6 BC030295 NM_152559 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113243 M01C083B19 pDONR221 IMS05-C10 BC030295 NM_152559  
HGE113291 M01C083D19 pDONR221 IMS05-C10 BC030295 NM_152559  
HGE113339 M01C083F19 pDONR221 IMS05-C10 BC030295 NM_152559 done
HGE113387 M01C083H19 pDONR221 IMS05-C10 BC030295 NM_152559  
HGE113435 M01C083J19 pDONR221 IMS05-C10 BC030295 NM_152559  
HGE113483 M01C083L19 pDONR221 IMS05-C10 BC030295 NM_152559  
HGE113531 M01C083N19 pDONR221 IMS05-C10 BC030295 NM_152559  
HGE113579 M01C083P19 pDONR221 IMS05-C10 BC030295 NM_152559  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243868 ARiS109L04 pGCAP10 NM_152559.2  
GCCTGTTGCCCACACGCCCGAGGCGCGCTGGATTGGCGGATGTGGCCACCCTGCTGTACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl