Prev. |  KEGG KO K02153 > 

RIKEN DNA Bank Human Resource - ATP6V0E2

Gene ID NCBI Gene 155066 |  KEGG hsa:155066
Gene Symbol ATP6V0E2
Protein Name ATPase H+ transporting V0 subunit e2
Synonyms ATP6V0E2L|C7orf32
Ortholog resources KEGG ortholog (KEGG orthology K02153) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006079 IRAK015D07 pCMV-SPORT6 BC015899 NM_145230 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068830 ARe72B06 pKA1U5 NM_145230.2  
GCCTGCATCCTGCCTGGGCATCCTGCGCCCGGCCATGACGGCGCACTCATTCGCCCTCCC
HKR078406 ARe96A06 pKA1U5 NM_145230.2  
GGCACCTGCAGCGCCCGCTGCTCGGCCCTGCATCCTGCCTGGGCATCCTGCGCCCGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl