Prev. | 

RIKEN DNA Bank Human Resource - BMT2

Gene ID NCBI Gene 154743 |  KEGG hsa:154743
Gene Symbol BMT2
Protein Name base methyltransferase of 25S rRNA 2 homolog
Synonyms C7orf60|SAMTOR
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362948 RBd07G04 pGCAP10 NM_152556.2  
GGGGGAGCGTCTGCGGGGGCCTGAGGGGCGGCGGCGGCGGCGGCGGCTGCGATATGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl