Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BMT2

Gene ID (NCBI) 154743
Gene Symbol BMT2
Protein Name base methyltransferase of 25S rRNA 2 homolog
Synonyms C7orf60
Databases KEGG hsa:154743 |  NCBI Gene 154743


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR362948 RBd07G04 pGCAP10 NM_152556.2  
GGGGGAGCGTCTGCGGGGGCCTGAGGGGCGGCGGCGGCGGCGGCGGCTGCGATATGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl