Prev. |  KEGG KO K12848 > 

RIKEN DNA Bank Human Resource - ZMAT2

Gene ID NCBI Gene 153527 |  KEGG hsa:153527
Gene Symbol ZMAT2
Protein Name zinc finger matrin-type 2
Synonyms Ptg-12|Snu23
Ortholog resource in our bank

  ZMAT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099349 IRAL048G05 pDNR-LIB BC056668 NM_144723 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004568 W01A011G24 pENTR-TOPO IRAL048G05 BC056668 NM_144723  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045322 ARe13F02 pKA1U5 NM_144723.1  
TTGACTTCGCTGTGAAGATGGCGTCGGGCAGCGGGACAAAAAACTTGGACTTTCGCCGAA
HKR397374 RBd93H06 pGCAP10 NM_144723.1  
ACTTCGCTGTGAAGATGGCGTCGGGCAGCGGGACAAAAAACTTGGACTTTCGCCGAAAGT
HKR428183 RBdS070H15 pGCAP10 NM_144723.1  
GACTTCGCTGTGAAGATGGCGTCGGGCAGCGGGACAAAAAACTTGGACTTTCGCCGAAAG
HKR461801 RBdS154I09 pGCAP10 NM_144723.1  
GACTTCGCTGTGAAGATGGCGTCGGGCAGCGGGACAAAAAACTTGGACTTTCGCCGAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl