Prev. | 

RIKEN DNA Bank Human Resource - NCBP2AS2

Gene ID NCBI Gene 152217 |  KEGG hsa:152217
Gene Symbol NCBP2AS2
Protein Name NCBP2 antisense 2 (head to head)
Synonyms HIAR|KRASIM|NCBP2-AS2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082468 IRAL006C20 pOTB7 BC000257
HGY100361 IRAL050P01 pOTB7 BC062368

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172927 ARi32F07 pGCAP10 NR_024388.1  
GGGGTTCCGGGCGCTTGGAGAAGATGGTGCTGCGGCGGCTGCTGGCCGCCCTGCTGCACA
HKR320803 RBb02A03 pKA1U5 NR_024388.1  
HKR386804 RBd67A04 pGCAP10 NR_024388.1  
GGGAAGANGAGGGCGGCGAGGTCGGGTTCCGGGCGCTTGGAGAAGATGGTGCTGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl