Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCBP2-AS2

Gene ID (NCBI) 152217
Gene Symbol NCBP2-AS2
Protein Name NCBP2 antisense RNA 2 (head to head)
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082468 IRAL006C20 pOTB7 BC000257
HGY100361 IRAL050P01 pOTB7 BC062368

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172927 ARi32F07 pGCAP10 NR_024388.1  
GGGGTTCCGGGCGCTTGGAGAAGATGGTGCTGCGGCGGCTGCTGGCCGCCCTGCTGCACA
HKR320803 RBb02A03 pKA1U5 NR_024388.1  
HKR386804 RBd67A04 pGCAP10 NR_024388.1  
GGGAAGANGAGGGCGGCGAGGTCGGGTTCCGGGCGCTTGGAGAAGATGGTGCTGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl